Chiudi

Aggiungi l'articolo in

Chiudi
Aggiunto

L’articolo è stato aggiunto alla lista dei desideri

Chiudi

Crea nuova lista

Creation
Creation
Dati e Statistiche
Fuori di libri Post sulla Community Fuori di libri
Wishlist Salvato in 0 liste dei desideri
Creation
Scaricabile subito
9,49 €
9,49 €
Scaricabile subito
Chiudi
Altri venditori
Prezzo e spese di spedizione
ibs
9,49 € Spedizione gratuita
scaricabile subito scaricabile subito
Info
Nuovo
Altri venditori
Prezzo e spese di spedizione
ibs
9,49 € Spedizione gratuita
scaricabile subito scaricabile subito
Info
Nuovo
Altri venditori
Prezzo e spese di spedizione
Chiudi

Tutti i formati ed edizioni

Chiudi
Creation
Chiudi

Promo attive (0)

Chiudi

Informazioni del regalo

Descrizione


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Leggi di più Leggi di meno

Dettagli

2013
Testo in en
Tutti i dispositivi (eccetto Kindle) Scopri di più
Reflowable
9780141970226

Conosci l'autore

Adam Rutherford

1975, Ipswich

Adam Rutherford è un divulgatore scientifico e conduttore televisivo inglese. Ha studiato Genetica allo University College London, dove ha anche partecipato alla scoperta della prima causa genetica di una particolare forma di cecità infantile. Rutherford ha scritto e presentato in televisione molte serie originali, più volte premiate, e programmi per la BBC di grande popolarità in Inghilterra, e ha scritto per le pagine scientifiche del «Guardian». Presso Bollati Boringhieri ha pubblicato Breve storia di chiunque sia mai vissuto. Il racconto dei nostri geni (2017) e Cosa rispondere a un razzista. Storia, scienza, razza e realtà (2020).

Chiudi
Aggiunto

L'articolo è stato aggiunto al carrello

Compatibilità

Formato:

Gli eBook venduti da Feltrinelli.it sono in formato ePub e possono essere protetti da Adobe DRM. In caso di download di un file protetto da DRM si otterrà un file in formato .acs, (Adobe Content Server Message), che dovrà essere aperto tramite Adobe Digital Editions e autorizzato tramite un account Adobe, prima di poter essere letto su pc o trasferito su dispositivi compatibili.

Compatibilità:

Gli eBook venduti da Feltrinelli.it possono essere letti utilizzando uno qualsiasi dei seguenti dispositivi: PC, eReader, Smartphone, Tablet o con una app Kobo iOS o Android.

Cloud:

Gli eBook venduti da Feltrinelli.it sono sincronizzati automaticamente su tutti i client di lettura Kobo successivamente all’acquisto. Grazie al Cloud Kobo i progressi di lettura, le note, le evidenziazioni vengono salvati e sincronizzati automaticamente su tutti i dispositivi e le APP di lettura Kobo utilizzati per la lettura.

Clicca qui per sapere come scaricare gli ebook utilizzando un pc con sistema operativo Windows

Chiudi

Aggiungi l'articolo in

Chiudi
Aggiunto

L’articolo è stato aggiunto alla lista dei desideri

Chiudi

Crea nuova lista

Chiudi

Inserisci la tua mail

Chiudi

Chiudi

Siamo spiacenti si è verificato un errore imprevisto, la preghiamo di riprovare.

Chiudi

Verrai avvisato via email sulle novità di Nome Autore